Exploration of Immunology

Table 1. Primer sequences were used for reverse transcription-polymerase chain reaction (RT-PCR) and to discriminate human factor H (FH), FH-like-1 (FHL-1), and FH-related protein-1 (FHR-1)

Primer name	Sequence	mRNA target
FH short consensus repeat 2 (SCR2)	Forward: AGGCCCTGTGGACATC Reverse: AACTTCACATATAGGAATATC	FH and FHL-1, across exons 3–4, SCR2 (5’ end)
FH exon 9/11	Forward: CTACTCCCAGATGCATCCGTGT Reverse: GGTTGAGCTGACCATCCATCTTT	FH, across exons 9–11 (middle)
FH SCR20	Forward: CATCCGTGTGTAATATCCCG Reverse: TCTTTTTGCACAAGTTGGATAC	FH, across exons 22–23, SCR20 (3’ end); potentially FHR-1 across exons 5–6
FHL-1	Forward: CATCCGTGTCAGCTTTACCCT Reverse: CCATTCTGGCTGGAATAATACAC	FHL-1 unique 4 amino acid tail
FHR-1	Forward: GTACTGTGGGCGGATTCACA Reverse: CTCTGTTGGGGGAGAAGAAAAATA	FHR-1 A and B, exons 1–4
Cyclophilin	Forward: GGCAAATGCTGGACCCAACACAAA Reverse: CTAGGCATGGGAGGGAACAAGGAA	Cyclophilin A, housekeeping gene

Return to article view

Declarations

Acknowledgments

Thank you to Dr Sheila Cabezas-Falcon for advice. Thank you to Mr Luke Kris for laboratory assistance.

Author contributions

JGD: Conceptualization, Formal analysis, Investigation, Writing—original draft, Writing—review & editing. BA: Conceptualization, Supervision, Writing—review & editing. EC and VS: Formal analysis, Investigation, Writing—review & editing. DLG: Conceptualization, Funding acquisition, Writing—review & editing. JMC: Conceptualization, Funding acquisition, Supervision, Writing—review & editing. All authors read and approved the submitted version.

Conflicts of interest

The authors declare that they have no conflicts of interest.

Ethical approval

Not applicable.

Consent to participate

Not applicable.

Consent to publication

Not applicable.

Availability of data and materials

The datasets generated for the mass spectrometry for this study can be found at https://zenodo.org/record/6911339#.YuDXjHZByUl. MP4 digital multimedia images from confocal microscopy are available at https://youtu.be/C7wO1RE_wdw and https://youtu.be/mjwsZh8lshU.

Funding

This study was supported by funding from the Flinders Foundation. JGD is supported by a scholarship from the Australian Government Research Training Program. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright

References

Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. The global distribution and burden of dengue. Nature. 2013;496:504–7. [DOI] [PubMed] [PMC]

Guzman MG, Harris E. Dengue. Lancet. 2015;385:453–65. [DOI] [PubMed]

WHO T. Dengue: Guidelines for Diagnosis, Treatment, Prevention and Control. Geneva: World Health Organization; 2009.

Halstead SB, editor. Dengue. World Scientific; 2008.

Nguyen TH, Lei HY, Nguyen TL, Lin YS, Huang KJ, Le BL, et al. Dengue hemorrhagic fever in infants: a study of clinical and cytokine profiles. J Infect Dis. 2004;189:221–32. [DOI] [PubMed]

Beatty PR, Puerta-Guardo H, Killingbeck SS, Glasner DR, Hopkins K, Harris E. Dengue virus NS1 triggers endothelial permeability and vascular leak that is prevented by NS1 vaccination. Sci Transl Med. 2015;7:304ra141. [DOI] [PubMed]

Modhiran N, Watterson D, Muller DA, Panetta AK, Sester DP, Liu L, et al. Dengue virus NS1 protein activates cells via Toll-like receptor 4 and disrupts endothelial cell monolayer integrity. Sci Transl Med. 2015;7:304ra142. [DOI] [PubMed]

Puerta-Guardo H, Biering SB, de Sousa FTG, Shu J, Glasner DR, Li J, et al. Flavivirus NS1 Triggers Tissue-Specific Disassembly of Intercellular Junctions Leading to Barrier Dysfunction and Vascular Leak in a GSK-3β-Dependent Manner. Pathogens. 2022;11:615. [DOI] [PubMed] [PMC]

Nascimento EJ, Silva AM, Cordeiro MT, Brito CA, Gil LH, Braga-Neto U, et al. Alternative complement pathway deregulation is correlated with dengue severity. PLoS One. 2009;4:e6782. [DOI] [PubMed] [PMC]

10.

Cabezas S, Bracho G, Aloia AL, Adamson PJ, Bonder CS, Smith JR, et al. Dengue Virus Induces Increased Activity of the Complement Alternative Pathway in Infected Cells. J Virol. 2018;92:e00633–18. [DOI] [PubMed] [PMC]

11.

Conde JN, Silva EM, Barbosa AS, Mohana-Borges R. The Complement System in Flavivirus Infections. Front Microbiol. 2017;8:213. [DOI] [PubMed] [PMC]

12.

Carr JM, Cabezas-Falcon S, Dubowsky JG, Hulme-Jones J, Gordon DL. Dengue virus and the complement alternative pathway. FEBS Lett. 2020;594:2543–55. [DOI] [PubMed]

13.

Serna M, Giles JL, Morgan BP, Bubeck D. Structural basis of complement membrane attack complex formation. Nat Commun. 2016;7:10587. [DOI] [PubMed] [PMC]

14.

Ricklin D, Reis ES, Mastellos DC, Gros P, Lambris JD. Complement component C3 – The “Swiss Army Knife” of innate immunity and host defense. Immunol Rev. 2016;274:33–58. [DOI] [PubMed] [PMC]

15.

Atkinson C. The complement system in health and disease. In: Virella G, editor. Medical Immunology. London: Informa UK Limited; 2019. pp. 93–114. [DOI]

16.

Wong EKS, Kavanagh D. Diseases of complement dysregulation-an overview. Semin Immunopathol. 2018;40:49–64. [DOI] [PubMed] [PMC]

17.

Lubbers R, van Essen MF, van Kooten C, Trouw LA. Production of complement components by cells of the immune system. Clin Exp Immunol. 2017;188:183–94. [DOI] [PubMed] [PMC]

18.

Mathern DR, Heeger PS. Molecules Great and Small: The Complement System. Clin J Am Soc Nephrol. 2015;10:1636–50. [DOI] [PubMed] [PMC]

19.

Al-Shujairi WH, Clarke JN, Davies LT, Pitman MR, Calvert JK, Aloia AL, et al. In vitro and in vivo roles of sphingosine kinase 2 during dengue virus infection. J Gen Virol. 2019;100:629–41. [DOI] [PubMed]

20.

Ansarah-Sobrinho C, Nelson S, Jost CA, Whitehead SS, Pierson TC. Temperature-dependent production of pseudoinfectious dengue reporter virus particles by complementation. Virology. 2008;381:67–74. [DOI] [PubMed] [PMC]

21.

Gualano RC, Pryor MJ, Cauchi MR, Wright PJ, Davidson AD. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 1998;79:437–46. [DOI] [PubMed]

22.

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2^−ΔΔ^C_T Method. Methods. 2001;25:402–8. [DOI]

23.

Blackmore TK, Sadlon TA, Ward HM, Lublin DM, Gordon DL. Identification of a heparin binding domain in the seventh short consensus repeat of complement factor H. J Immunol. 1996;157:5422–7. [PubMed]

24.

Coulson-Thomas VJ, Gesteira TF. Dimethylmethylene Blue Assay (DMMB). Bio Protoc. 2014;4:e1236. [DOI]

25.

Sharma S, Chataway T, Burdon KP, Jonavicius L, Klebe S, Hewitt AW, et al. Identification of LOXL1 protein and Apolipoprotein E as components of surgically isolated pseudoexfoliation material by direct mass spectrometry. Exp Eye Res. 2009;89:479–85. [DOI] [PubMed]

26.

Jammart B, Michelet M, Pécheur EI, Parent R, Bartosch B, Zoulim F, et al. Very-low-density lipoprotein (VLDL)-producing and hepatitis C virus-replicating HepG2 cells secrete no more lipoviroparticles than VLDL-deficient Huh7.5 cells. J Virol. 2013;87:5065–80. [DOI] [PubMed] [PMC]

27.

Cabezas-Falcon S, Norbury AJ, Hulme-Jones J, Klebe S, Adamson P, Rudd PA, et al. Changes in complement alternative pathway components, factor B and factor H during dengue virus infection in the AG129 mouse. J Gen Virol. 2021;102:001547. [DOI] [PubMed] [PMC]

28.

Sumpter R Jr, Loo YM, Foy E, Li K, Yoneyama M, Fujita T, et al. Regulating intracellular antiviral defense and permissiveness to hepatitis C virus RNA replication through a cellular RNA helicase, RIG-I. J Virol. 2005;79:2689–99. [DOI] [PubMed] [PMC]

29.

Wati S, Soo ML, Zilm P, Li P, Paton AW, Burrell CJ, et al. Dengue virus infection induces upregulation of GRP78, which acts to chaperone viral antigen production. J Virol. 2009;83:12871–80. [DOI] [PubMed] [PMC]

30.

Martin M, Leffler J, Smoląg KI, Mytych J, Björk A, Chaves LD, et al. Factor H uptake regulates intracellular C3 activation during apoptosis and decreases the inflammatory potential of nucleosomes. Cell Death Differ. 2016;23:903–11. [DOI] [PubMed] [PMC]

31.

Leffler J, Herbert AP, Norström E, Schmidt CQ, Barlow PN, Blom AM, et al. Annexin-II, DNA, and histones serve as factor H ligands on the surface of apoptotic cells. J Biol Chem. 2010;285:3766–76. [DOI] [PubMed] [PMC]

32.

Rastogi M, Sharma N, Singh SK. Flavivirus NS1: a multifaceted enigmatic viral protein. Virol J. 2016;13:131. [DOI] [PubMed] [PMC]

33.

Modhiran N, Watterson D, Blumenthal A, Baxter AG, Young PR, Stacey KJ. Dengue virus NS1 protein activates immune cells via TLR4 but not TLR2 or TLR6. Immunol Cell Biol. 2017;95:491–5. [DOI] [PubMed]

34.

Benfrid S, Park KH, Dellarole M, Voss JE, Tamietti C, Pehau-Arnaudet G, et al. Dengue virus NS1 protein conveys pro-inflammatory signals by docking onto high-density lipoproteins. EMBO Rep. 2022;23:e53600. [DOI] [PubMed] [PMC]

35.

Zhang J. Development of an in-vitro dendritic cell model for studying dengue virus and host interaction [dissertation]. Hong Kong: Hong Kong Polytechnic University; 2013.

36.

Lord MS, Melrose J, Day AJ, Whitelock JM. The Inter-α-Trypsin Inhibitor Family: Versatile Molecules in Biology and Pathology. J Histochem Cytochem. 2020;68:907–27. [DOI] [PubMed] [PMC]

37.

Niranjan R, Kishor S, Kumar A. Matrix metalloproteinases in the pathogenesis of dengue viral disease: Involvement of immune system and newer therapeutic strategies. J Med Virol. 2021;93:4629–37. [DOI] [PubMed]

38.

Krause KK. Defining the Role of Alpha-Macroglobulins in the Pathogenesis of Flavivirus Encephalitis [dissertation]. Honolulu (HI): University of Hawaiʻi at Mānoa Library; 2018.

39.

Huerta V, Toledo P, Fleitas N, Martín A, Pupo D, Yero A, et al. Receptor-activated human α₂-macroglobulin interacts with the envelope protein of dengue virus and protects virions from temperature-induced inactivation through multivalent binding. J Gen Virol. 2014;95:2668–76. [DOI] [PubMed]

40.

Brasier AR, Zhao Y, Wiktorowicz JE, Spratt HM, Nascimento EJ, Cordeiro MT, et al. Molecular classification of outcomes from dengue virus -3 infections. J Clin Virol. 2015;64:97–106. [DOI] [PubMed] [PMC]

41.

Giang NT, van Tong H, Quyet D, Hoan NX, Nghia TH, Nam NM, et al. Complement protein levels and MBL2 polymorphisms are associated with dengue and disease severity. Sci Rep. 2020;10:14923. [DOI] [PubMed] [PMC]

42.

Puerta-Guardo H, Glasner DR, Harris E. Dengue Virus NS1 Disrupts the Endothelial Glycocalyx, Leading to Hyperpermeability. PLoS Pathog. 2016;12:e1005738. [DOI] [PubMed] [PMC]

43.

Blaum BS, Hannan JP, Herbert AP, Kavanagh D, Uhrín D, Stehle T. Structural basis for sialic acid-mediated self-recognition by complement factor H. Nat Chem Biol. 2015;11:77–82. [DOI] [PubMed]

44.

Perkins SJ, Fung KW, Khan S. Molecular Interactions between Complement Factor H and Its Heparin and Heparan Sulfate Ligands. Front Immunol. 2014;5:126. [DOI] [PubMed] [PMC]

45.

Hyvärinen S, Meri S, Jokiranta TS. Disturbed sialic acid recognition on endothelial cells and platelets in complement attack causes atypical hemolytic uremic syndrome. Blood. 2016;127:2701–10. [DOI] [PubMed]

46.

Dopler A, Stibitzky S, Hevey R, Mannes M, Guariento M, Höchsmann B, et al. Deregulation of Factor H by Factor H-Related Protein 1 Depends on Sialylation of Host Surfaces. Front Immunol. 2021;12:615748. [DOI] [PubMed] [PMC]

47.

Chen Y, Maguire T, Hileman RE, Fromm JR, Esko JD, Linhardt RJ, et al. Dengue virus infectivity depends on envelope protein binding to target cell heparan sulfate. Nat Med. 1997;3:866–71. [DOI] [PubMed]